Alpha-amylase powder, system name 1,4-alpha-D-glucan glucan hydrolase, also known as liquefying amylase or liquefying enzyme -1, 4-Dextrinase. Yellow brown solid powder or yellow brown to dark brown liquid, with a moisture content of 5% to 8%. Soluble in water, insoluble in ethanol or ether. According to FAO/WHO regulations, ADI has no special restrictions. Mainly used for hydrolyzing starch to produce maltose, glucose, and syrup, as well as for producing dextrin, beer, yellow wine, alcohol, soy sauce, vinegar, fruit juice, and monosodium glutamate. It is also used in the production of bread to improve dough, such as reducing dough viscosity, accelerating fermentation process, increasing sugar content, and slowing down bread aging. Used for pre-treatment of cereal raw materials in infant and toddler food. In addition, it is also used in vegetable processing. Usage case, based on Bacillus subtilis alpha amylase (6000IU/g), the addition amount is about 0.1%
Alpha amylase, as an endonuclease capable of hydrolyzing -1,4-glycosidic bonds in starch molecules, has become one of the most widely used enzymes in industrial biotechnology due to its efficient catalytic properties for starch liquefaction. Its applications cover more than ten fields such as food processing, fermentation industry, textile printing and dyeing, medicine and health, papermaking and environmental protection, and demonstrate the potential for continuous expansion in emerging technologies.
The application in the food industry runs through the entire chain of raw material processing, process optimization, and product innovation, and its temperature resistance, pH adaptability, and catalytic efficiency have become the key to industry technological upgrading.
1. Baking industry: dual optimization of volume and taste
In bread production, damaged starch in flour is hydrolyzed to produce dextrin and reducing sugars, providing more substrates for yeast fermentation. Experimental data shows that adding 0.01% fungal alpha amylase can increase the volume of bread by 15% -20%, while reducing sugars participate in the Maillard reaction, resulting in a 20% -30% increase in the color of bread skin. In the application of frozen dough, this enzyme can delay starch aging, reduce the hardness of the product by 40% after thawing, and maintain a soft texture for up to 7 days.
2. Brewing industry: synergistic improvement of efficiency and quality
Beer brewing: High temperature resistant alpha amylase (stable activity at 90-95 ℃) can replace 30% malt, shorten starch liquefaction time from 60 minutes to 15 minutes, increase wort filtration speed by 25%, and increase extract yield by 5%. Enzyme preparations derived from Bacillus licheniformis can increase beer fermentation by 3% and reduce residual sugar content to below 1.2%.
alpha-amylase powder and saccharifying enzyme complex preparation in the saccharification stage, the starch utilization rate increased from 85% to 92%, and the liquor yield rate increased by 8%. At the same time, the production of fusel oil was reduced, making the liquor body more pure.
3. Starch sugar manufacturing: the conversion hub from raw materials to high value-added products
In glucose production, starch is liquefied to dextrin with a DE value of 15-20, and then converted into glucose through enzymatic action. The use of high-temperature resistant alpha amylase (such as BLA genetically engineered enzyme) can increase the liquefaction temperature from 85 ℃ to 95 ℃, shorten the reaction time by 50%, and reduce energy consumption by 30%. In the production of malt syrup, by controlling the enzymatic hydrolysis conditions (pH 5.5-6.0, 60 ℃), products with malt sugar content of over 60% can be obtained, meeting the demand of the food industry for low sweetness and anti crystallization syrup.
4. Development of healthy food: Balancing functionality and clean labeling
For special food for diabetes, resistant dextrin can be prepared by cooperating with pullulanase. Its dietary fiber content is more than 85%, and the GI value (glycemic index) is less than 30. In the production of gluten free bread, this enzyme can improve the processing characteristics of non gluten raw materials such as big Rice noodles and quinoa flour, so that the specific volume of the product is increased from 2.5 mL/g to 3.8 mL/g, and the sensory score is close to that of traditional wheat bread.
By efficiently converting starch based raw materials into fermentable sugars, it has become a core tool for the production of biofuels, organic acids, and amino acids. Its thermal stability and catalytic efficiency directly affect the economic viability of the industry.
1. Fuel ethanol: a key technology for energy transition
In the production of corn fuel ethanol, alpha amylase (such as Spezyme) ® The synergistic effect of Alpha and glucose amylase can increase the starch conversion rate to over 98%. The thermophilic - amylase improved by gene editing technology can maintain activity at 95 ℃, combining liquefaction and saccharification processes (SSF process), reducing steam consumption by 40%, and shortening the fermentation cycle to 48 hours. In 2023, the global production of bioethanol will reach 105 million tons, with alpha amylase contributing over 60% of the starch conversion efficiency.
2. Organic acids and amino acids: a bridge from raw materials to high-value products
Citric acid production: Alpha amylase pretreatment liquefies corn starch to a DE value of 10-12, followed by fermentation by Aspergillus niger. The citric acid yield increases from 1.2kg/kg starch to 1.5kg/kg starch, and the fermentation time is shortened by 20%.
Sodium glutamate (MSG): In the saccharification stage of starch raw materials, adding a composite preparation of alpha amylase and amylase can increase the glucose yield from 90% to 95%, increase the conversion rate of monosodium glutamate to 65%, and reduce the energy consumption per unit product by 25%.
3. Biobased materials: conversion from starch to biodegradable plastics
The synergistic effect with lipase can prepare starch polylactic acid composite materials, which have a tensile strength of 35MPa and an elongation at break increased to 120%, meeting the mechanical performance requirements of packaging materials. In the production of polyhydroxyalkanoates (PHA), enzyme pretreatment increased starch saccharification efficiency by 40%, increased PHA yield from 0.8g/L to 1.2g/L, and reduced production costs by 30%.
By efficiently removing starch slurry from fabrics, it becomes the core enzyme preparation for textile printing and dyeing pretreatment processes. Its low-temperature activity and environmental protection characteristics promote the industry's transformation towards green manufacturing.
1. Desizing process: dual optimization of efficiency and environmental protection
Traditional chemical desizing needs to be carried out at 90-95 ℃, generating a large amount of alkaline wastewater. The use of medium temperature - amylase (with stable activity at 50-60 ℃) can shorten the desizing time from 120 minutes to 45 minutes, reduce steam consumption by 60%, and decrease the COD (chemical oxygen demand) of wastewater from 5000mg/L to 800mg/L. In denim desizing, the enzyme works synergistically with cellulase to increase the surface finish by 30%, dye depth by 15%, and reduce indigo dye shedding rate by 20%.
2. Biological polishing: precise control of fabric surface properties
The composite preparation with cellulase can selectively remove surface fuzz from cotton fabrics, improving the surface smoothness by 40% and increasing the anti pilling level from level 3 to level 4-5. In silk processing, this enzyme can reduce fabric stiffness by 25% while maintaining its original luster, meeting the demands of high-end clothing fabrics.
3. Environmental printing and dyeing: from end of pipe treatment to source pollution reduction
The use of alpha amylase desizing process can reduce the cost of wastewater treatment by 40%, and its biodegradability (96 hour degradation rate>90%) meets the OEKO-TEX Standard 100 environmental protection standard. In the pre-treatment of digital printing, this enzyme can replace traditional caustic soda desizing, increasing the color yield by 15% and color fastness by 0.5 levels, while reducing wastewater discharge by 30%.
The applications in the pharmaceutical field cover diagnostic reagents, digestive enzyme preparations, and biomaterial development, and their specificity and safety have become key clinical applications.
1. Disease diagnosis: "biomarkers" of acute pancreatitis
The detection of serum alpha amylase activity is the preferred screening indicator for acute pancreatitis (AP). Enzyme activity can increase to more than three times the normal value (>120U/L) within 2-12 hours after onset, and the duration of elevated urinary amylase is longer (5-10 days). Combined with lipase detection (specificity>95%), the diagnostic accuracy can be increased to 98% and the misdiagnosis rate can be reduced by 30%. In cystic fibrosis (CF) screening, saliva alpha amylase activity testing can identify more than 85% of patients early, which is more convenient than traditional sweat chloride ion testing.
2. Digestive enzyme preparations: the core components of functional foods
For patients with chronic pancreatitis, a compound digestive enzyme preparation (containing alpha amylase, lipase, protease) can increase fat digestion rate by 40% and carbohydrate absorption rate by 35%. Adding acid resistant alpha amylase (pH 2.0 activity stable) to infant formula can increase starch digestibility from 70% to 90%, reducing the incidence of digestive symptoms such as bloating and diarrhea by 50%.
3. Biomaterials: Innovative carriers for drug delivery systems
Starch nanoparticles modified with α - amylase (particle size 100-200nm) can be used as anti-cancer drug carriers, with a drug loading capacity of 25% and a 24-hour release rate of>80% in a simulated intestinal environment (pH 6.8). In oral insulin formulations, the enzyme combined with chitosan encapsulation technology can increase the bioavailability of the drug to 15%, reducing medication frequency by 70% compared to traditional injections.
alpha-amylase powder has become a key tool for improving product quality and reducing energy consumption in the paper industry. Its application covers the entire process of coating, sizing, and waste paper deintercalation.
1. Starch coating improvement: precise control of paper properties
In the coating process, partial degradation of starch by alpha amylase (DE value 5-10) can reduce coating viscosity by 30%, increase coating speed to 1500m/min, and improve paper glossiness by 20%. The printability score is also improved by 15 points (on a 100 point scale). In the production of specialty paper, the enzyme and polyvinyl alcohol composite coating can increase the water resistance of the paper by 40%, meeting the requirements of food packaging materials.
2. Optimization of glue application process: dual benefits of energy conservation and environmental protection
Pre treatment of rosin gum with alpha amylase can reduce the sizing temperature from 85 ℃ to 60 ℃, decrease steam consumption by 30%, and reduce the amount of gum material by 20%. In the process of ink removal from waste paper, the synergistic effect of this enzyme and lipase can increase the ink removal rate to 95%, increase the whiteness by 5%, and reduce the fiber loss rate to below 3%.
3. Biopulping: The transition from chemical to biological methods
The composite preparation of alpha amylase and xylanase can replace 20% of chemical pulping agents, reducing the kappa number of pulp by 15% while maintaining the same strength performance. In straw pulping, enzyme pretreatment can increase fiber separation efficiency by 30%, reduce energy consumption by 40%, and reduce wastewater pollution load by 90%.
With the development of gene editing technology and nanotechnology, innovative potential has been demonstrated in cutting-edge fields such as synthetic biology, space life support, and bioremediation.
1. Synthetic Biology: Design and Evolution of Artificial Enzymes
Through directed evolution techniques, researchers have developed mutants that are resistant to high temperatures (110 ℃) and acid (pH3.0), with a half-life 10 times longer than the wild type. In the artificial starch synthesis pathway, synergistic action with starch synthase can increase starch production from 0.1g/L to 5g/L, providing carbon source reserves for space life support systems.
2. Space technology: material cycling in closed ecosystems
In the Bioregenerative Life Support System (BLSS) of the International Space Station (ISS), starch based substances in astronaut excrement are decomposed with a recovery rate of 90%, providing inorganic salts for plant cultivation. In the Mars base simulation experiment, the enzyme works synergistically with photosynthetic bacteria to increase carbon dioxide fixation efficiency by 25% and oxygen production rate by 15%.
3. Bioremediation: Green Governance of Soil Pollution
Magnetic nanoparticles modified with α - amylase (Fe ∝ O ₄ @ SiO ₂ - AMY) can efficiently adsorb polycyclic aromatic hydrocarbons (PAHs) in soil, with an adsorption capacity of 50mg/g and a degradation rate of>80% in 24 hours at 30 ℃. In the remediation of oil contaminated soil, the enzyme combined with lipase can increase the total petroleum hydrocarbon (TPH) degradation rate to 90% and shorten the remediation period to 6 months.
Preparation of alpha-amylase powder:
The construction process of vector pxmj19-aph213 is as follows:
The aph213 gene was amplified from the vector xk99e with the primers aph213F and aph213R. The primers used were as follows:
aph213F:ccggatatcagcttcacgctgccgcaagcac
aph213R:ccgaagcttaattctgtttcctgtgtgaaattg
PCR conditions are as follows: 95 ℃ for 4 min; 95 ℃ 30s, 62 ℃ 30s, 72 ℃ 1min, 35 cycles; 72℃ 7min.
The design of the above primers led to the formation of EcoRV breakpoint at the upstream of the aph213 gene and HindIII breakpoint at the downstream during the amplification of the aph213 gene. The nucleotide sequence of the aph213 gene is shown in SEQ ID NO: 4; The PCR product was recovered and digested with EcoRV and HindIII, and then connected to the vector pxmj-19 which was also digested with EcoRV and HindIII through T4DNA ligase to obtain the vector pxmj19-aph213.
The amplification process of vector pxmj19-aph213 is as follows:
A. Add 3ml of LB culture medium and 1.5ul of 34mg/ml chloramphenicol antibiotic into 50ml centrifuge tube;
B. Select Escherichia coli DH5 with vector pxmj19-aph213 Transfer to the above medium and culture at 37 ℃ and 230 rpm for 12 hours to amplify the pxmj19-aph213 plasmid;
C. Extract the pxmj19-aph213 plasmid according to the instructions of the plasmid extraction kit.
Amplified from Bacillus subtilis genome with primer AmyF and AmyR - The primers used for amylase gene are as follows:
PCR conditions are as follows: 95 ℃ for 4 min; 95 ℃ 30s, 62 ℃ 30s, 72 ℃ 2min, 35 cycles; 72℃7min.
The design of the above primers makes - During the amplification of amylase gene - The e3 SD sequence is formed in the upstream of the amylase gene and the histidine tag is formed in the downstream. The upstream restriction endonuclease site is HindIII, and the downstream restriction endonuclease site is XhoI;
The PCR product was recovered and digested with XhoI and HindIII, and then connected to the vector pxmj19-aph213 which was also digested with XhoI and HindIII through T4 DNA ligase to obtain the recombinant expression vector pxmj19-aph213-amy.
The recombinant expression vector pxmj19-aph213-amy was transferred into Escherichia coli for pre-amplification. The culture medium was LB medium and the concentration of chloramphenicol was 50 ug/ml; After extraction, it was transferred into Corynebacterium glutamicum by the method of electrical transformation, and cultured in LBHIS recovery medium at 30 ℃, with the concentration of chloramphenicol of 30 ug/ml.
Transfer the grown transformants to a 250ml triangular flask containing 50ml medium for culture. The medium is BHI medium. The culture condition is 30 ℃, 230 rpm, 48 h.
A. Centrifuge the culture of recombinant bacteria at 12000 rpm, 4 ℃ and 5 min to obtain - The supernatant of amylase.
B. Will contain - The supernatant of amylase is subjected to affinity chromatography. First, balance the nickel column with buffer A - The supernatant of amylase was filtered and loaded to the balanced nickel column, and then the volume of three columns was further balanced with buffer A to the baseline level; Elute with 100mmol of B solution, collect the eluted eluate, and collect 0.5ml per tube;
Buffer A: 300mM NaCl, 20mM Tris, pH8.0 buffer; buffer B: 300mM NaCl, 250mM imidazole, 20mM Tris, pH8.0 buffer.
C. For those containing - The eluate of amylase is desalted through the desalting column to obtain purified - Amylase solution, stored at - 20 ℃;
The buffer used for desalting is 50mM PBS buffer with pH 7.0.
Populära Taggar: alpha-amylase powder cas 9000-90-2, suppliers, manufacturers, factory, wholesale, buy, price, bulk, for sale